ONEXI_VECTORIZED_CPU_GENOMIC_ENGINE • 33 NCBI GENETIC CODES • R1CS ZERO-LOSS VERIFIED

Deterministic Genomic De-Coding, ONE XI Gene Editor & 3-Layer Physiological Modeling

Powered by our Vectorized CPU engine (GPU/TPU acceleration planned) under the zeroH Invariance Framework (δ = 0.0). Translate coding sequences across all 6 reading frames, design precision CRISPR / Base / Prime Editing (pegRNA) constructs, profile transmembrane hydropathy, and generate cryptographically signed provenance ledgers.

Compute Substrate

Vectorized CPU

GPU/TPU Planned

Solver Latency

0.13 ms

Server-Side Solver

Structural Drift

δ = 0.0000

Bijective R1CS

Provenance Seal

QAT'I 1.0

SHA-256 + ZK

Verified Loci:

Interactive 3D B-DNA Manifold (Drag or Speed Slider)

333 bp

A • Adenine

T/U • Thymine

G • Guanine

C • Cytosine

01 // Sovereign DNA → mRNA → Peptide De-Coder & Point-Mutation Lab

Paste or upload a coding sequence, adjust Reading Frame (φ ∈ {0,1,2}) or NCBI Genetic Code, and click any codon chip to test single-nucleotide mutations.

📂 Upload FASTA

5' → 3' Coding DNA Sequence (FASTA or Raw ACGT) 333 nt (111 codons)

NCBI Genetic Code

Strand Polarity

Reading Frame

Nucleotide Composition & Shannon Entropy COMPLIANT (≤ 4.114 bits)

106

109

GC Content (Tm: 88.4°C) 64.56%

Shannon H(X) 1.9375 bits

Est. pI

5.39

GRAVY Hydropathy

+0.214

Cysteine (S-S)

6 Cys (3 S-S)

VERIFIED_COMPUTED_PASS • Human Preproinsulin (INS • 110 aa + TAG Stop)

δ = 0.0 | Coherence: 1.0000

Transcribed mRNA Sequence (5' → 3') Terminal Stop: TAG (UAG • Amber)

Primary Polypeptide Sequence (Single-Letter IUPAC) 110 Amino Acids • 11.98 kDa

Interactive Codon Matrix (Click Any Codon to Mutate Single Bases)

Hydrophobic Polar Charged Stop

Hover or click any codon chip above to open the Single-Nucleotide Point-Mutation Sandbox.

AQL PRECISION GENE EDITOR v1.0 • CRISPR-Cas9 / Cas12a • ABE8e / BE4max • Prime Editing PE3 (pegRNA)

02 // ONE XI BIO Gene Editor & Therapeutic Construct Designer

Scan forward and reverse strands for PAM sites (`NGG` / `TTTV`), evaluate Base Editing bystander windows (positions 4–8), synthesize full-length Prime Editing `pegRNA` (`Spacer + Scaffold + RTT + PBS`), and verify pre/post-edit structural coherence under The Ark Sealed Invariant Gate.

AQL Molecular Gene-Editing Telemetry Feed CRISPR / pegRNA VISUALIZER

Configure Precision Genomic Edit (v6.0.0)

Target Gene Coding Sequence (Default: HBB Sickle-Cell E6V GTG)

Editing Modality

Target Codon # (1-Based)

Replacement Codon (3 nt)

Active Codon Shift

Ready to compute...

On-Target Efficiency

—

SpCas9 NGG

Amino Acid Repair

—

Precision Edit

Ark Coherence Retention

0.9942

SEALED_PROPRIETARY_PASS

zeroH Gate Status

QAT'I 1.0

SHA256 Verified

Synthesized Guide RNA & Prime Editing Construct (5' → 3') PE3 Prime Editing Active

20-nt Protospacer (sgRNA)

--------------------

Primer Binding Site (PBS 13-nt)

-------------

RT Template (RTT 16-nt)

----------------

Full-Length Engineered pegRNA (Spacer + Cas9 Hairpin Scaffold + RTT + PBS) 125 nt

Loading engineered pegRNA construct...

Ranked CRISPR / Cas9 & Cas12a PAM Guides Near Target Locus Top Ranked Guides

Rank	Enzyme / Strand	20-nt Spacer (5'→3')	PAM	Cut Dist	GC%	On-Target	Bystander Risk

02A // Kyte-Doolittle Hydropathy Profile (Window = 7 aa)

Positive peaks (> +1.6) indicate hydrophobic signal peptides or transmembrane helices; negative troughs indicate solvent-exposed loops.

KD-7 Curve

02B // Simultaneous 6-Frame Open Reading Frame (ORF) Scanner

Instantaneous translation across Sense (+0, +1, +2) and Antisense (−0, −1, −2) reading frames.

6-Frame Parallel

03 // 3-Layer Physiological Hormone & Peptide Cartography

AQL MVP #4 automatically maps translated polypeptides across Layer 1 (Genomic Exon/Codon Architecture), Layer 2 (Post-Translational Cleavage & Disulfide Folding), and Layer 3 (Endocrine & Cardiovascular Receptor Signaling).

ACTIVE ATLAS: HUMAN INSULIN (INS • 11p15.5)

LAYER 01 // GENOMIC LOCUS Chr 11p15.5

Exon-Intron Splicing & Codon Optimality

Canonical 333-bp coding sequence spliced across Exons 2 and 3. High GC density (64.56%) stabilizes mRNA secondary stem-loops inside pancreatic β-cell ribosomes.

Initiation Context:Kozak GCCATGG (ATG #1)

Spliced CDS Window:[0 .. 333] (111 triplets)

Shannon Base Entropy:1.9375 bits / base

LAYER 02 // PROTEOLYTIC FOLDING 3 Disulfide Bridges

Prepropeptide Cleavage & Domain Map

ER signal peptidase cleaves the 24-aa Signal Peptide (MALW...PAAA), yielding Proinsulin. Prohormone convertases (PC1/3, PC2) excise the 31-aa C-Peptide between dibasic RR and KR motifs.

Signal Peptide (aa 1–24) ER Translocation

B-Chain (aa 25–54 • 30 aa) FVNQ...YTPKT

C-Peptide (aa 57–87 • 31 aa) EAED...GSLQ

A-Chain (aa 90–110 • 21 aa) GIVE...NYCN

LAYER 03 // PHYSIOLOGICAL AXIS INSR Tyrosine Kinase

Endocrine & Metabolic Homeostasis

Mature heterodimeric Insulin engages the α2β2 Insulin Receptor (INSR), activating IRS-1/PI3K/Akt cascades to translocate GLUT4 vesicles in skeletal muscle, myocardium, and adipose tissue.

Primary Target Organs:Myocardium, Muscle, Liver

Disulfide Topology:A7-B7, A20-B19, A6-A11

Clinical Biomarker:Equimolar C-Peptide Secretion

04 // Compute Execution Ledgers & R1CS Cryptographic Provenance Vault

Live execution telemetry on our Vectorized CPU engine (GPU/TPU acceleration planned) and Groth16/Plonk R1CS zero-loss provenance receipts.

SUBSTRATE A // HOST COMPUTE

Vectorized CPU Engine

ACTIVE

Execution Mode

SIMD Vectorized

Solver Time

0.13 ms

Accelerator Roadmap

GPU/TPU Planned

Invariant δ

0.000000

SUBSTRATE B // MATRIX PIPELINE

Vectorized Matrix Pipeline (GPU/TPU Planned)

CPU SIMD

Contraction

1.35 ms

Surface Integral

0.104589

Residual δ

0.000000

Runtime

Linux x86_64

R1CS PROVENANCE CERTIFICATE

Groth16 / Plonk Hybrid Circuit

QAT'I 1.0

Proof ID:zkAQL-88961667aa7d1717

SHA-256 Digest:fca80cdee67f...c2b42

R1CS Gates (MUL/SUB/EQ):3/3 SATISFIED

Author Provenance:ONE XI BIO™

VECTORIZED_CPU_ENGINE (GPU/TPU Acceleration Planned) Deterministic Clinical Sequence Synthesis (T = 0.0, δ = 0.0)

📄 Download Executive Brochure (PDF)

Click "⚡ RUN CPU ENGINE BENCHMARK" above to execute live vectorized CPU sequence decoding & clinical synthesis on the active sequence.

ClinVar Missense Pathogenicity Benchmark & Black-Box Variant Scorer

NCBI ClinVar Verified • n = 1,457 Variants • Within-Gene AUROC = 0.8831

Blind Empirical Validation (GRCh38)

ClinVar Pathogenic vs. Benign Missense Discrimination

0.8831 AUROC

Evaluated across 1,457 RefSeq CDS-verified human missense variants (853 Pathogenic/Likely Pathogenic, 604 Benign/Likely Benign) spanning 28 clinical disease genes (TP53, BRCA1, BRCA2, CFTR,HBB, LDLR, SCN5A, MYH7, KCNQ1, MLH1, MSH2, PTEN, RET, VHL, etc.).

Predictor / Method	Overall AUROC	95% CI	Within-Gene
AQL Ark Clinical (AVIS v3.0)	0.8796	0.8615–0.8983	0.8831
AQL Ark Sequence-Only (AVIS v2.0)	0.7090	0.6831–0.7344	0.7015
BLOSUM62 Substitution Baseline	0.6924	0.6656–0.7186	0.6894
Grantham Chemical Distance (1974)	0.6565	0.6290–0.6852	0.6673
AQL Ark 3-Radical Root Delta (ΔR)	0.6230	0.5944–0.6518	0.6541

Sequence-Only Lift

+5.25 pts vs Grantham

Top Gene (HBB / LDLR)

0.9852 / 0.9462

Dataset SHA-256

8f4eb1e5...f7890

Live Black-Box API • POST /api/variant-score

Test Any Missense Variant (AVIS v3.0)

Ref Codon (3 nt)

Alt Codon (3 nt)

UCSC phyloP100way

gnomAD Allele Freq

Gene o/e Missense

Amino Acid Substitution: GAG (E) → GTG (V)

Ark 3-Radical Projection: Root Δ = 0.2593

AVIS v2.0 (Sequence-Only): 0.4612

AVIS v3.0 (Clinical Score): 0.7945 • PATHOGENIC

ONE XI GENESIS v4.0 Universal Suite: 3D Structural Epistasis, Splice ΔΨ, Bayesian ACMG/AMP & Inverse mRNA Compiler

100% Coding + Non-Coding Genome • Tavtigian Bayesian ACMG • Multi-Host mRNA/LNP Optimizer

Universal Coding & Non-Coding Variant Triage

AVIS v4.0 (3D ΔΔG + Splice ΔΨ + NMD + Bayesian ACMG)

POST /api/universal-variant

Gene & Ref→Alt

3D RSA [0=Core, 1=Surf]

Pocket Dist (Å)

Junction Dist / Intron

Consequence & HGVS: missense_variant • TP53 p.R175H

3D Fold Stability (ΔΔG) & Pocket Boost: +2.64 kcal/mol • 1.71x Catalytic Boost

Splicing ΔΨ & NMD 55-nt Status: ΔΨ = 0.0000 • NMD: False

Active ACMG/AMP Evidence Codes: PM2_Supporting, PM1, PP2, PP3_Strong

AVIS v4.0 & Bayesian Posterior: 984.2 • P = 0.9941 • Pathogenic (Class 5)

Transcript 3D Foldability vs. Intrinsic Disorder Profile: Top: Folded Core (High Impact) | Bottom: Disordered Loop

Inverse Therapeutic Payload Design (Protein → mRNA/DNA)

Multi-Host CAI, Uridine-Depletion & mRNA/LNP Compiler

POST /api/codon-optimize

Target Therapeutic Protein Sequence (AA)

Host Expression System

CAI Adaptiveness

0.9142 (+218%)

Wobble Uridine %

0.00% (TLR7 Stealth)

GC% & Folding ΔG

63.9% • -51.7 kcal

Restriction Sites

8/8 Cleared

Full Clinical mRNA Construct (5'-Cap1 + HBA1 UTR + Kozak + CDS + UGA-UAA + 3'-UTR + Segmented PolyA): 715 nt

Compiling optimal clinical mRNA sequence...

ONE XI™ Bio-Quantum Infusion: GF(4) Codon Syndrome Healer & DF-THC Active-Site Hamiltonian Compressor

12-Qubit TwoPointerGapBank • 1-Ancilla GF(4) Karatsuba • Signed-Gauge Givens Trees

Benchmark II Quantum Error-Correction Infusion

GF(4)³ = GF(64) Codon Syndrome Decoder & Algebraic Mutation Healer

POST /api/one-xi-quantum

Reference Wild-Type Coding Sequence (Mapped to GF(4)³ = GF(64) Syndrome Registers)

TwoPointerGapBank

12 Qubits (-65.7%)

GF(4) Karatsuba Ancilla

1 Qubit (-83.3%)

Syndrome Heal Status

0 Drift (0.09 ms)

Located Mutated Codon Pointers (6-bit p0, p1): Codons [2, 33] (p0=3, p1=34)

1-Ancilla GF(64) Karatsuba Sample Product: ATG ⊗ GCC → CAC (1 Ancilla)

Algebraically Restored Wild-Type CDS (0 Residual Codon Mismatches):

ATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTGGCCCTCTGGGGACCTGACCCAGCCGCAGCCTTTGTGAACCAACACCTGTGCGGCTCACACCTG

Benchmark I & III Quantum Chemistry & QROM Infusion

Moore-Penrose DF-THC Metalloenzyme Pocket & Prefix-Möbius QROM

C++20 kickmix.pyd

Givens Tree Depth

4 (-73.3% vs 15)

Signed-Gauge Violations

0 (6 Ancillas Freed)

QROM Switch Reduction

96.5% (115 vs 3282)

Pebbling Q²×T Save

92.44% (588 vs 7776)

Target Active-Site Metalloenzyme Hamiltonian: AQL-TX-001_Cardio_Metalloenzyme (N=16, M=32)

DF-THC Relative Frobenius Error / λ_eff: 0.000554 • λ = 148.38 (Exact Gauge)

Benchmark I (1/√x) • Benchmark II (DQI) • Benchmark III (FeMoCo): 76q/1363T • 881q (27.4x Q²T) • 124q/5264T

Zero-Drift Fuzz Verification (2,048 Shots): VERIFIED_ZERO_DRIFT (0 Bit Mismatches)

ONE XI GENESIS

Sign in with Google

Interactive User Guide // How to Operate ONE XI GENESIS v2.3

Deterministic Genomic De-Coding, ONE XI Gene Editor & 3-Layer Physiological Modeling

01 // Sovereign DNA → mRNA → Peptide De-Coder & Point-Mutation Lab

02 // ONE XI BIO Gene Editor & Therapeutic Construct Designer

02A // Kyte-Doolittle Hydropathy Profile (Window = 7 aa)

02B // Simultaneous 6-Frame Open Reading Frame (ORF) Scanner

03 // 3-Layer Physiological Hormone & Peptide Cartography

Exon-Intron Splicing & Codon Optimality

Prepropeptide Cleavage & Domain Map

Endocrine & Metabolic Homeostasis

04 // Compute Execution Ledgers & R1CS Cryptographic Provenance Vault

Vectorized CPU Engine

Vectorized Matrix Pipeline (GPU/TPU Planned)

Groth16 / Plonk Hybrid Circuit

ClinVar Missense Pathogenicity Benchmark & Black-Box Variant Scorer

ClinVar Pathogenic vs. Benign Missense Discrimination

Test Any Missense Variant (AVIS v3.0)

ONE XI GENESIS v4.0 Universal Suite: 3D Structural Epistasis, Splice ΔΨ, Bayesian ACMG/AMP & Inverse mRNA Compiler

AVIS v4.0 (3D ΔΔG + Splice ΔΨ + NMD + Bayesian ACMG)

Multi-Host CAI, Uridine-Depletion & mRNA/LNP Compiler

ONE XI™ Bio-Quantum Infusion: GF(4) Codon Syndrome Healer & DF-THC Active-Site Hamiltonian Compressor

GF(4)³ = GF(64) Codon Syndrome Decoder & Algebraic Mutation Healer

Moore-Penrose DF-THC Metalloenzyme Pocket & Prefix-Möbius QROM